QUESTION #1 (CAN I GET THIS TODAY BEFORE MIDNIGHT) ANSWER DOESN’T HAVE TO BE LONG.
Genetic mutation is what leads to the mechanism of natural selection, and thus contributes directly to evolution, a necessary and useful process. The crossing over and randomization at fertilization also increases variation. Without the variation that results from mutations, natural selection would not occur, thus proving that genetic mutations are beneficial and crucial for life. However, cancer is a disease caused by mutation. Does this mean that cancer is inescapable for all humans if we simply live long enough?

QUESTION #2 (I DONT NEED THIS ONE UNTIL TOMORROW).

Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation. Also write out the corresponding RNA sequence:AGTAAACGTACCTGAGACGGG
Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.

 
“Looking for a Similar Assignment? Order now and Get 10% Discount! Use Code “Newclient”